The complete puc18kan vector dna sequence is included as a text file in supporting information file. N and c are, as you thought the nterminal and cterminal tags, often it is a bit counterintuitive for these though, for example in the pegfpc1 plasmid, if you clone into this, the gfp will be nterminal to the insert i. Intracellular bacterial growth is controlled by a kinase. Dynamic association of egfprab5 and egfp2xfyve with mtb phagosomes occurs in the first 5 min after internalization, related to figure 1. Construction of a eukaryotic expression vector for pegfp. Restriction map and multiple cloning site mcs of pires2egfp. Target sequences were determined using crisprdirect 61 supplementary figures 1d and 4c and introduced into px330pgkpuro. Claudin1 is a metastasis suppressor and correlates with clinical outcome in lung adenocarcinoma yuchih chao, szuhua pan, shuennchen yang, sungliang yu, tingfang. Identification and characterization of toxoplasma gondii. Vector database is a digital collection of vector backbones assembled from publications and commercially available sources. The vector backbone of puc18 was obtained by pcr with primers puc18f and puc18r, and the kanamycin resistance cassette from pegfpc1 clontech with primers kanrinpucf and kanrinpucr. Differential expression and functional characterization of. The pcr fragment was cloned into pgemteasy promega, and then pegfp c1 clontech, to obtain constructs encoding aminoterminal enhancedgfptagged rab14.
Restriction map and multiple cloning site mcs of pacgfp1c1. Restriction map and multiple cloning site mcs of pegfpn1 vector. Cloning vector pegfpc1, complete sequence, enhanced green fluorescent protein egfp and neomycin phosphotransferase genes, complete cds 4,731 bp circular dna u55763. Tokue is a global leader in biotechnology innovation, offering great benefits and applications to the biopharmaceutical and diagnostic industries as well as for biotechnology research communities. If you wish to digest the vector with these enzymes, you will need to transform the vector into a dam host and make fresh dna. From pu6pyltmcs, the u6pylt cassette was excised with spei and nhei, and ligated into a unique nhei site in the same plasmid, yielding p2u6pyltmcs which contains two copies of u6pylt. Samhd1 is a nuclear protein that blocks lentiviral infection before reverse transcription in macrophages and dendritic cells. Description pegfpc1 encodes redshiftedvariant wildtypegfp whichhas been optimized brighterfluorescence higherexpression mammaliancells. Mhgx contains a factor xa cleavage site between egfp and the protein of interest. By continuing to use this site, you agree to the use of cookies. The xba i and bcl i sites are methylated in the dna provided by bd biosciences clontech. Since the pegfp vector carries the egfp gene, any expressed fusion proteins from the pegfp plasmid will contain both the target protein and the egfp protein. Arf1 recruits coat proteins to the golgi membranes when it is bound to gtp. Without the addition of a functional promoter, this vector will not express egfp.
The attached sequence file has been compiled from information in the sequence databases, published literature, and other sources, together with partial sequences obtained by clontech. Note the enrichment of vpsa in both vpsamyc or vpsagfp lanes. Cloning and characterization of adpribosylation factor 1b. To see this sequence with restriction sites, features, and translations, please download snapgene or the free snapgene viewer. Promoters should be cloned into the pegfp1 mcs upstream from the egfp coding sequences. The xba i site is methylated in the dna provided by clontech. Welcome to vector database vector database is a digital collection of vector backbones assembled from publications and commercially available sources. The gfp reporters whose expression is controlled by either mir32 or mir23 were constructed by annealed primers cloned into the bamhihindiii sites of pegfpc1 mir32 target sens, agcttgatgcagctttgcaatatgctg, mir32. The eukaryotic expression vector pegfpc1bmp2 was originally generated and transfected into cos7 cells to explore the function of bmp in bone and cartilage development. C1 vector dna clontech, palo alto, ca, usa or pcdna vector or pcdna vector containing a human fc fragment of igg1 were added, the mixture was transferred into an electroporation cuvette and placed in the nucleofector device amaxa.
The recombinant egfp vector can be transfected into mammalian cells using any standard transfection method. Description plps3egfp acceptor vector is designed to be used with bd biosciences clontech pdnrdual donor vector to rapidly generate reporter constructs expressing a fusion between the 3 terminal of a protein of interest and enhanced green fluorescent protein egfp. This is a free resource for the scientific community that is compiled by addgene this page is informational only this vector is not available from addgene please contact the manufacturer for further details. Using the pegfpc1 vector with lipofectamine2000 on 293t cells, you can easily produce stably transfected cells. Cloning and characterization of adpribosylation factor 1b from the olive flounder paralichthys olivaceus sohee son1. The cells were harvested at different time points 48, 72 and 96 h posttransfection and stained with equal volume of 0. Interestingly, the migration of cells transfected with pegfpc1bmp2 plasmid was significantly increased at 36 and 48 h compared with the control group and the pegfpc1 group p clontech. The pegfpc1 plasmid was used as a template, and the. Vector for fusing egfp to the nterminus of a partner protein. Cloning vector pdeltae1sp1acmvgfp, complete sequence 8,068 bp linear dna af288620. Research article open access fhl1c induces apoptosis.
A rab20dependent membrane trafficking pathway controls m. Pegfpc1 vector information pt30285 vector information. Mountain view, ca 94043 technical support us email. Ddx49 is an rna helicase that affects translation by. Location of features human cytomegalovirus cmv immediate early promoter. The class i duplicated arf gene was cloned and characterized from the olive flounder paralichthys olivaceus for. A practical comparison of ligationindependent cloning. Restriction map and multiple cloning site mcs of pegfpc1. This project is supported bytokuewhich specializes in manufacturing ultrapure antibiotics for a broad spectrum of biotechnology applications as well as for the pharmaceutical industry. The 585 bp pcr product was cloned and confirmed by dna sequencing. I sites are methylated in the dna provided by bd biosciences clontech. Sequences flanking acgfp1 have been converted to a kozak consensus translation initiation site 1 to further increase the translation efficiency in eukaryotic cells.
Cell surface flipflop of phosphatidylserine is critical. Role of samhd1 nuclear localization in restriction of hiv. Chinese cuisine wei chuan pdf download free software. A 48 hours after transfection with either vpsamyc or vpsagfp, hek293t cells were processed for immunoblotting using antibodies against vpsa and atubulin.
With regards to the correct concentration, may i suggest you perform a g418 titration curve. This is a free resource for the scientific community that is compiled by addgene. The fulllength fhl1c cdna was inserted into the expression vectors pegfpc1 clontech, mountain view, ca and pcmvmyc clontech to generate pegfpfhl1c and pcmvmycfhl1c, respectively. The attached sequence file has been compiled from information in the sequence databases, published litera. Pdf a novel terminator primer and enhancer reagents for. Cos7 and lgcs were transiently transfected with pegfpc1lhra, pegfpc1lhrd, pegfpc1lhra, and pdsredmonomerc1empty or pegfpc1lhra and pdsredmonomerc1lhrd. Here, we describe the single oligonucleotide mutagenesis and cloning approach soma that is independent of restriction sites and only requires a single mutagenic oligonucleotide to modify a plasmid. Cos7 cells were transfected by electroporation as described above, seeded in poly d lysinecoated glassbottom culture dishes maltek, ashland, ma 1.